Table 23.5. Lipinski Data for the Top 10 Ligands in Each Library (CB306, HF9, InHouse, NIH Clinical Collection). Lipinski Rules Changed to <700 g/mol and <2.5 LogP value.
Analysis: Based on the screening process, the NIH Clinical Collection ligands were most worth pursuing due to their high fitness scores. However, many of these compounds had values that did not satisfy the modified Lipinski or were unavailable. Thus, Enalaprilat from the NIH Clinical Collection and AC1OPXUX from the CB306 library are the compounds that have the highest hopes in binding during the inhibition assay due to their high fitness scores and their drug-like physicochemical properties.
Figure 23.4. Positive inhibitor 3 as green sticks with active site of SaSTP1 (PDB ID:2PK0) as pink sticks with magnesium cofactors as lime green spheres. Polar contacts shown in black dashes.
Figure 23.3. Negative Control 5 as green sticks with active site of SaSTP1 (PDB ID:2PK0) as pink sticks with magnesium cofactors as lime green spheres. Polar contacts shown in black dashes.
Analysis: These are the binding poses of the top positive and top negative control. As expected, the top positive control seems to bind correctly, making polar contacts with the magnesium cofactors which are both necessary for binding. The negative control, on the other hand, doesn't seem to make any polar controls to one of the magnesium cofactors, indicating that although it had a high score compared to some of the ligands, it most likely will not bind well in vitro.
Table 23.2. Fitness scores and bond subscores as determined by GOLD of the control library containing 11 positive controls and 5 negative/random controls.
Rank
Score
S(PLP)
S(h bond)
S(cho)
S(metal)
DE(clash)
DE(tors)
intcor
Ligand name
1
65.82
-31.6
5.59
0
3
0
0.3
0.09
'Pos3_10921447'
2
62.73
-30.46
4.85
0
3
0
0.22
0.16
'Pos9_12124355'
3
62.48
-41.53
3.49
0
1.97
0
1.38
1.4
'Pos2_10379025'
4
58.96
-30.33
3.88
0
2.94
0
0.43
0.2
'Pos7_11151757'
5
57.75
-35.51
3.94
0
1.99
0
1.28
1.02
'Pos1_10880008'
6
57.25
-41.04
1.9
0
1.91
0
0.5
0.06
'Neg5_57781497'
7
54.93
-29.58
2.74
0
2.92
0
0.26
0.12
'Pos5_11183084'
8
54.06
-40.79
1.99
0.72
1.21
0
1.24
0.32
'Neg3_11835383'
9
53.43
-38.36
1.56
0
1.91
0
0.53
0
'Neg2_729602'
10
52.89
-27.9
2.48
0
2.99
0
0.25
0.12
'Pos11_20262261'
11
52.82
-28.93
2.24
0
2.94
0.1
0.25
0.13
'Pos4_11031366'
12
52.6
-29.76
2.28
0
2.94
0
0.82
0.01
'AspirinNeg1_2244'
13
51.77
-45.18
1
0
0.97
0
1.26
0.3
'Neg4_2245652'
14
47.54
-24.62
2
0
2.84
0
0.12
0.14
'Pos8_10877388'
15
41.15
-12.02
3.71
0
3
0
0
0
'Pos6_13818'
16
36.83
-11.67
2.57
0
2.91
0
0
0
'Pos10_197063'
Analysis: Overall, the scores are pretty low but it may just be the protein or the specific run. The control docking validated GOLD because most of the positive controls were seen towards the top of the ranks. Some reasons for the lower scoring positive controls are that the inhibitors were found in viral organisms instead of bacteria and that they are not specifically for STP1 but rather for general serine/threonine phosphatase.
Table 23.1. The physicochemical properties of the control library used to validate GOLD.
Analysis: The positive controls were chosen because they are already known inhibitors of Serine-Threonine Phosphatases. The negative controls were chosen based on similar physicochemical properties. However, it is unlikely that they will bind because the current inhibitors do not have that much in common so the filtered search range was pretty large. The negatives also all have ring structures while only one of the positive controls have a single ring structure. Thus it is even more unlikely that they will bind successfully.
Inhibition Assay
Figure 22.3. Absorbance measurements at 410 nm for trial 2 of varying inhibitor compound concentrations against the enzyme YopH using pNPP as a substrate. Four total controls indicated: no enzyme control, two no inhibitor controls, and one positive orthonavadate control). N=1 so no standard deviation error bars were created.
Figure 22.2. Absorbance measurements at 410 nm for trial 1 of varying inhibitor compound concentrations against the enzyme YopH using pNPP as a substrate. Four total controls indicated: no enzyme control, two no inhibitor controls, and one positive orthonavadate control). N=1 so no standard deviation error bars were created.
Analysis: In both trials, the inhibition assay did not work. In trial 1, the positive control had absolutely no signal as compared to the no enzyme control which was unusual because although it is supposed to successfully inhibit the YopH enzyme from working, there should be a small amount of signal rather than no signal at all. In trial 2, the exact opposite was true where the signal from the positive control was about equal to the signals received when no inhibitor was added at all. This indicates that the positive control did not actually successfully inhibit all of the enzyme. Furthermore, compound 5852635, which had been proven to indeed inhibit YopH by others' research, also transmitted a large signal when added. It is likely that this was the result of choosing a saturated enzyme concentration from the enzymatic assay. As can be seen in the enzyme assay graph, the absorbance readings began to level off as the concentration was increased. Thus, in the inhibitory assay, there was likely not enough inhibitor compound to inhibit the exceedingly large amount of enzyme in the reactions. The most important piece of information taken from the inhibition assay was that as the inhibitor compound was increased in concentration, the absorbance measurement did decrease showing that the compound was somewhat effective and that the source of error was indeed the amount of enzyme added to the reaction.
Enzyme Assay
Figure 22.1. Absorbance measurements at 410 nm for varying enzymatic concentrations in nM of YopH with standard deviation error bars. Second point is an outlier. Reaction used pNPP as a substrate (more information can be found in the materials and methods portion).
Analysis: With the exception of the second point as an outlier, the absorbance measurement at 410 nm increased as the enzyme concentration increased. This is because there was more enzyme to catalyze the reaction involving the cleaving of the phosphate group off of the substrate pNPP. With the addition of NaOH, a p-Nitrophenylene anion is formed which is yellow is color and absorbs wavelengths at about 410 nm. The second the last point on the graph was the chosen concentration for inhibition assays.
Week 13 & 14
FPLC (Fast Protein Liquid Chromatography)
Figure 21.6. Absorbance measured at 280 nm of YopH after FPLC and being concentrated with a concentration of 1.06 mg/ml.
Analysis: The resulting concentration was 1.06 mg/ml which is a pretty decent concentration. The purified enzyme will be used in enzymatic assays next to ensure that they are functional before moving on to inhibitory assays.
Figure 21.5. Concentration of 0.43 mg/ml for YopH after FPLC with absorbance measured at 280 nm.
Analysis: The concentration was considerably lower after FPLC. However, this can be increased by spinning down the sample in a concentrator.
Figure 21.4. FPLC of YopH indicated in solid blue separated into tubes labeled in red. Size standard comparison run separately indicated in dashed blue line to help identify correct protein.
Analysis: Before FPLC, two samples were combined to increase the concentration because a lot of the sample is lost during FPLC. The size standard run is indicated in the blue dotted line where the largest peak on that line corresponds to a size of approximately 50 kDa. The smaller peak towards the end (right) of the graph corresponds to a size of approximately 30 kDa. Thus, it was evident that the largest peak on the blue solid line was the YopH protein at approximately 34 kDa. The peak corresponded to tubes 39-44 which were collected while the rest of the sample was discarded.
Protein Characterization
Figure 21.3. SDS-Page gel run with 1x TGS buffer. PageRuler Prestained Protein Ladder #SM0671 (reference left) in well 1, sample 0 (cell lysate before induction) in well 2, sample 1 (cell lysate after induction) in well 3, sample 2 (soluble fraction) in well 4, sample 3 (flow through) in well 5, sample 4 (wash step) in well 6, sample 5 (elution 1) in well 7, and sample 6 (elution 2) in well 8.
Analysis: The protein ended up in the elution 1 and elution 2 samples as expected which can be seen by the large bands at approximately 34 kDa, the size of YopH. There was, however, more contamination than wanted. Thus, it was decided that the samples would be put through a second degree of purification by running it through fast protein liquid chromatography.
Protein Purification
Figure 21.3. Absorbance measured at 280 nm for the purified YopH surrogate protein from the expression vector E. coli BL21(DE3) resulting in a concentration of 0.46 mg/ml.
Figure 21.2. Absorbance measured at 280 nm for the purified YopH protein from the expression vector E. coli BL21(DE3) resulting in a concentration of 2.12 mg/ml.
Analysis: The concentration for elution 1 was pretty high but not abnormally high indicating good protein expression. As expected, the elution 2 concentration was lower but not 0 because most of the protein was eluted the first time with only some remaining because of the level of buffer above the resin. The sample may need to be further purified through FPLC depending on what the elution samples look like on the protein characterization gel.
Protein Expression
Figure 21.1. Spinned down lysed E. coli BL21(DE3) cells. Supernatant discarded with pellet on right representing remaining protein.
Analysis: The OD600 of the cells was measured before inducing them with IPTG to ensure that the E. coli BL21(DE3) cells were in log phase growth to optimize the protein recovery. A nice size pellet was formed, hopefully resulting in large protein yields.
Week 11 & 12
DNA Sequencing
Figure 20.2. Ordered samples (one using forward and one using reverse pLIC for each sample) created with 500 ng of purified pNIC-Bsa4 + CDS of SaSTP1.
Figure 20.1. Order summary of the 12 samples (one forward and one reverse primer for each sample obtained through mini-prep) submitted to the ICMB Core.
Analysis: There are a total of 12 samples because both forward and reverse primers are needed for each sample. This is because DNA sequencing tends to read worse towards the end of the frame. By having samples containing forward or reverse sequencing primers, the sequences can be aligned to determine whether a positive clone was present or not. The results came back and, as expected, were highly mutated. From here, protein protocol practice will be done on surrogate enzymes. In the event that there are positive clones made by my teammates, I will likely jump back onto this target.
Mini-Prep
Figure 19.6. Absorbance reading of sample 5 at 260 nm after mini-prep with concentration of 219.1 ng/ul and purity ratios of 1.83 (260/280) and 1.99 (260/230).
Figure 19.5. Absorbance reading of sample 7 at 260 nm after mini-prep with concentration of 62.4 ng/ul and purity ratios of 1.81 (260/280) and 1.68 (260/230).
Figure 19.4. Absorbance reading of sample 4 at 260 nm after mini-prep with concentration of 311.4 ng/ul and purity ratios of 1.77 (260/280) and 1.86 (260/230).
Figure 19.3. Absorbance reading of sample 3 at 260 nm after mini-prep with concentration of 331.6 ng/ul and purity ratios of 1.82 (260/280) and 2.03 (260/230).
Figure 19.2. Absorbance reading of sample 2 at 260 nm after mini-prep with concentration of 228.6 ng/ul and purity ratios of 1.82 (260/280) and 1.94 (260/230).
Figure 19.1. Absorbance reading of sample 1 at 260 nm after mini-prep with concentration of 229.9 ng/ul and purity ratios of 1.83 (260/280) and 1.98 (260/230).
Analysis: For all the samples, the concentration was only used in order to submit the correct amount in ng for DNA sequencing. They were not of great importance for yield because they just indicated how well the bacteria grew and did not account for mutations. Although the purity ratios were very close to acceptable values of a pure sample, again, this only shows that other things growing had been killed off by kanamycin, leaving only the potentially mutated bacteria.
pNIC-Bsa4 Cloning (Attempt 2 & 3)
Annealing and Transformation
Figure 18.2. Kanamycin and sucrose positive master plate made from the smaller colonies of the 4 transformation plates combined.
Figure 18.1. Kanamycin and sucrose positive agar transformation plates of BE21 competent cells with pNIC-Bsa4 and CDS of SaSTP1. Top left is a 1 pNIC-Bsa4 : 2 CDS of SaSTP1 ratio using the 28 ng/ul pNIC-Bsa4 sample. Bottom left is a 1 pNIC-Bsa4 : 9 CDS of SaSTP1 ratio using the 28 ng/ul pNIC-Bsa4 sample. Top right is a 1 pNIC-Bsa4 : 9 CDS of SaSTP1 ratio using the 35 ng/ul pNIC-Bsa4 sample. Bottom right is a 1 pNIC-Bsa4 : 2 CDS of SaSTP1 ratio using the 35 ng/ul pNIC-Bsa4 sample.
Analysis: The growth was highly unusual and may have indicated that the plates used did not actually have kanamycin on them. The select colonies used for the master plate were also grown up in LB that did contain kanamycin. Because some of these colonies did form pellets after centrifugation with the addition of kanamycinn, it is possible that they can be clones. Thus, DNA sequencing was done for the ones that made substantial pellets (#1, 2, 3, 4, 7, 9). However, because the outgrowth of "stuff" was so drastic in the original plates, it is likely that the bacteria forming these pellets are highly mutated and have been transformed with something else as well.
Week 9 & 10
pNIC-Bsa4 Cloning (Attempt 2 & 3)
Annealing and Transformation
Both samples as well as the PCR squared product had cohesive ends added to them. They were then combined. Each sample was split into two tubes. Tube A of both had a 1 pNIC-Bsa4 : 2 CDS ratio. Tube B of both had a 1 pNIC-Bsa4 : 9 CDS ratio. They were left to grow overnight. After one day, there were no signs of growth. However, after another day, some bacterial growth appeared. The plate was moved to the fridge for storage, and the colonies will be tested to see if there are any positive clones.
Re-Digest of pNIC-Bsa4 2 & 3
These samples were not checked on a gel to save some time.
*The grown pNIC-Bsa4 from before was separated into two different samples for two more attempts at cloning before being treated with restriction enzyme BsaI-HF.
Figure 17.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 35.6 ng/uL and purity ratios of 1.92 (260/280) and 1.95 (260/230).
Figure 17.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 36.0 ng/uL and purity ratios of 1.97 (260/280) and 2.42 (260/230).
Average Concentration: 35.8 ng/uL
Figure 16.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 28.2 ng/uL and purity ratios of 2.12 (260/280) and 2.28 (260/230).
Figure 16.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 29.4 ng/uL and purity ratios of 2.02 (260/280) and 2.10 (260/230).
Average Concentration: 28.8 ng/uL
Analysis (for both samples): Both samples had less concentration after it was treated with BsaI-HF and cleaned up. However, the concentration is still worth a try at cloning despite it being lower. The purity ratios were about the same as the first attempt at cloning.
NanoDrop of grown pNIC-Bsa4 (Second Time)
Figure 15.2. Absorbance of pNIC-Bsa4 purified from DH5alpha bacterial cells at wavelength 260 nm with concentration of 51.0 ng/uL and purity ratios of 1.96 (260/280) and 2.91 (260/230).
Figure 15.1. Absorbance of pNIC-Bsa4 purified from DH5alpha bacterial cells at wavelength 260 nm with concentration of 51.5 ng/uL and purity ratios of 1.87 (260/280) and 2.99 (260/230).
Average Concentration: 51.25 ng/uL
Analysis: Unfortunately, I accidentally eluted the pNIC-Bsa4 in 50 uL instead of 30 uL so the concentration is lower than it would have been otherwise. Despite this, the concentration was still higher than the first time growing pNIC-Bsa4. The purity ratios are also better.
PCR Clean-Drop & NanoDrop (Second Time)
Figure 14.2. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 180.5 ng/uL and purity ratios of 1.90 (260/280) and 2.34 (260/230).
Figure 14.1. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 178.9 ng/uL and purity ratios of 1.87 (260/280) and 2.32 (260/230).
Average Concentration: 179.7 ng/uL
Analysis: The concentration of this sample was much higher than the previous PCR clean-up, giving high hopes for successful cloning. The purity ratios are also much better with the ratio in proportion to other proteins very close to the acceptable value of 1.80 and the ratio in proportion to other contaminants much closer to the acceptable 2.10 as compared to the negative value obtained the first time. This PCR product will be inserted into pNIC-Bsa4 which will then be used to transform DH5alpha competent cells.
PCR Squared (Second Time)
Figure 13.1.
1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left) with four 3 uL samples of PCR squared reactions (wells 5-8) and secondary PCR in well 4 for comparison.
Analysis: In order to make more CDS for SaSTP1, PCR squared was done again from remaining secondary PCR product. Although the bands were not as high intensity as the last PCR squared, it may have just been because only 3 uL of each aliquot was run in each lane. There is still evidence that amplification occurred because the bands are slightly more intense than the secondary PCR sample in well 4. The concentration of the PCR squared product will be determined after PCR clean up to see if PCR squared must be redone.
Week 7 & 8
Great work in the wet lab Caroline. Great captions and analysis. Keep up the good work. Where exactly are you with virtual though? Thank you. -Max 10/21/13
pNIC-Bsa4 cloning
2) Cohesive End Generation, Annealing and Transformation (Attempt #1 - Failed): Cohesive ends were created by using T4 DNA polymerase to extend the sticky ends of both the PCR inserts (amplified CDS of SaSTP1 protein) and the accepting vector (pNIC-Bsa4). These were mixed in two different tubes, one with a 1:2 ratio of accepting vector to PCR insert, and the other with a 1:8 ratio of accepting vector to PCR insert. Competent DH5alpha bacterial cells were added to each tube which were then spread on kanamycin and sucrose positive LB agar plates in hopes of transforming them with the annealed plasmid containing the CDS.
Analysis: No bacterial growth appeared on the plates after an incubation period of 1-2 days at 37 degrees Celsius. This shows that transformation of the bacterial cells failed because none of the bacteria had kanamycin resistence (coded for in the pNIC-Bsa4 plasmid) and thus died.
Conclusion/Next Steps: There were no apparent faults such as using the wrong buffer, not having pNIC-Bsa4, or having incredibly low concentrations of both accepting vector and CDS. Some possible changes for the second attempt could include using more recent reagents and warmer SOC to ensure higher efficacy in transformation. However, because I currently have no more PCR product or pNIC-Bsa4 left, the first thing to do will be to make bulk of both before extra attempts at transforming.
1) pNIC-Bsa4 Clean Up, RE Digest, & Gel Check: The extracted pNIC-Bsa4 from the Midi-Prep protocol was run through the clean up kit to reduce contamination and treated with restriction enzyme BsaI-HF to see if the correct sequence was produced from transformation of the DH5alpha bacterial cells.
Figure 12.4. Virtual cut of pNIC-Bsa4 by restriction enzyme Bsa-I into two fragments of lengths 5353 bp and 1931 bp as provided by NEBCutter.
Figure 12.3. pNIC-Bsa4 (well 4) treated with restriction enzyme BsaI-HF with 1 kb ladder (reference left) in well 2.
-Ignore well 3. Accidentally loaded 100bp ladder.
Figure 12.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 40.6 ng/uL and purity ratios of 1.82 (260/280) and 2.57 (260/230).
Figure 12.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 38.1 ng/uL and purity ratios of 1.81 (260/280) and 2.83 (260/230).
Analysis: Based on the resitrction enzyme virtual cut, 2 fragments of lengths 5353 bp and 1931 bp should appear if the sequence cut is pNIC-Bsa4 (information obtained from NEBcutter). As seen in figure 12.3, this is exactly what appeared on the gel, indicating that the DNA extracted during midi-prep was indeed pNIC-Bsa4. After checking the concentration using the Nanodrop spectrophotometer, the average concentration was 39.35 ng/uL. This was, again, and okay yield. The reason for the higher concentration as compared to that measured after midi-prep is because of the volume of sample (in this case, it was 30 uL total). The purity ratio in respect to other proteins (260/280) was still within an acceptable range for both readings. Although the purity ratio in respect to other contaminants decreased from that measured during the Midi-Prep protocol, it was still not that close to the accepted value of 2.1. However, there are other purification processes that can be done later on if cloning is successful and the target protein is expressed. Hence, the sample was still used.
Midi-Prep (Extracting pNIC-Bsa4 from DH5alpha)
Figure 11.2. Absorbance of pNIC-Bsa4 extracted from DH5alpha bacterial cells at wavelength 260 nm with concentration of 32.4 ng/uL and purity ratios of 2.01 (260/280) and 3.50 (260/230).
Figure 11.1. Absorbance of pNIC-Bsa4 extracted from DH5alpha bacterial cells at wavelength 260 nm with concentration of 36.2 ng/uL and purity ratios of 2.00 (260/280) and 3.39 (260/230).
Analysis: The average concentration of both readings was 34.30 ng/uL. This is an okay yield so the sample was used in the following step of cutting the pNIC-Bsa4. The purity of the sample was good for the 260/280 ratio indicating not much contamination in respect to other proteins, but the value for the 260/230 ratio was high indicating other contaminants.
Conclusion: In this step, the accepting vector pNIC-Bsa4 that was grown up in DH5alpha bacterial cells was extracted. The absorbances of the obtained samples were measured using the Nanodrop spectrophotometer. After further preparation of the pNIC-Bsa4, it will be used to anneal to the CDS of the target protein SaSTP1 which will then be cloned in bacterial cells in order to obtain the target protein.
Note: I was supposed to send this to DNA sequencing but I forgot to do so before cutting it with the BsaI-HF restriction enzyme. However, as can be seen above, the RE digest did indicate that the sample was indeed pNIC-Bsa4.
Transformation of DH5alpha bacterial cells with pNIC-Bsa4
- pNIC-Bsa4 and bacteria were combined in a test tube, heat shocked, treated with SOC, and allowed to grow on LB agar plates. A secondary culture was made from one colony after a day. This was allowed to incubate for 18 hours (although the protocol said 16 hours max) before being spun down into pellets.
Analysis/Conclusion: The secondary culture was made in order to obtain a homogeneous sample. The pellets will used during Midi-Prep in which the pNIC-Bsa4 in the transformed bacterial cells will be extracted.
PCR Clean-Up & NanoDrop
Figure 10.2. The absorbance measurement at 260 nm for the same sample of CDS of STP1 in S. agalactiae after PCR clean-up with yield of 92.3 ng/uL and purity ratios of 1.91 (260/280) and -5.37 (260/230).
Figure 10.1. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 87.1 ng/uL and purity ratios of 1.88 (260/280) and -5.01 (260/230).
Analysis: The average yield after PCR clean-up was 89.7 ng/uL. Although the purity ratios indicated a considerable degree of contamination, this may have just been the result of using the incorrect elution buffer causing background noise to be picked up at the wavelengths measured. From here, the DNA will be inserted into pNIC-BSA4 which will then be used to transform bacteria in order to express large amounts of the STP1 (from S. agalactiae) protein.
Awesome job with the image labeling! But be sure to specify what is in each well in your captions. Keep up the good work! - Michael T.
Week 5 & 6
PCR Squared
Figure 9.1. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left) with four 50 uL aliquots of PCR squared reactions.
Analysis: PCR squared was successful as can be seen by the high intensity of the bands in all four aliquots. There was a bit of contamination that was also amplified, but an attempt at removing it will be made in PCR clean up. The bands are again at the expected length (738 bp). PCR squared may have to be done multiple times to obtain even more CDS for STP1 from S. agalactiae because both clean up and protein expression require a lot of DNA to be successful and have high yields.
Primary PCR & Secondary PCR
Figure 8.2. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left), primary PCR smear in well 3, and secondary PCR band in well 4 for the CDS of STP1 derived from S. agalactiae.
Analysis: Although the second run of primary PCR showed no visible smear on the gel, secondary PCR worked, indicating that primary PCR was also successful. This sample was much less contaminated than the first because autoclaved nanopure water was used and more care was taken, though not in handling the gel as can be seen by the crack that was caused by accidentally dropping the gel. HAHA. Luckily, the band for secondary PCR was still visible. Again, it appeared between the 700 and 800 bp bands, where it was expected to be (738 bp).
Figure 8.1. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left), primary PCR smear in well 3, and secondary PCR band in well 4 for the CDS of STP1 derived from S. agalactiae.
Analysis: The primary PCR reaction worked and showed a smear which was the result of amplification of varying lengths of the CDS. The secondary PCR showed a band at the expected amount of basepairs (738 bp) as can be seen when compared to the ladder, but also had a considerable amount of contamination. However, during secondary PCR, the lid of the machine was closed too tightly causing the tube to deform.Thus it was not possible to save the sample without risk of increased contamination. Both primary and secondary PCR were done a second time in order to decrease the amount of contamination.
Week 3 & 4
Caroline - good work, need one attempt at Primary PCR. - Dr. B 092513 Primer Tail Ordering
Figure 7.2. Order summary of the forward and reverse tail primers for the STP1 protein's CDS in S. agalactiae codon optimized for E. coli class II.
Analysis: These primer tails will be used later in secondary PCR to amplify the gene of interest (CDS of STP1 protein in S. agalactiae in this case).
Vector with Inserted Gene of Interest (Blue for 6HIS tag; yellow for tail primers that align with pNIC-Bsa4; green for start codon; purple for primer portion that overlaps with CDS; red for stop codon; underlined is the entire CDS) TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATC ATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGAAATCTCTCTCCTGACTGACATCGGTCAACGTCGCTCTAATAACCAGGACTTCATC AATCAGTTCGAAAACAAGGCCGGTGTTCCGCTCATCATCCTGGCGGACGGCATGGGCGGTCACCGTGCGGGTAACATTGCGAGCGAAATGACCGTTACCGATC TGGGCTCTGACTGGGCGGAAACCGACTTCTCTGAACTGTCTGAAATCCGTGACTGGATGCTCGTTTCTATCGAAACGGAAAACCGTAAAATCTACGAACTGGGTC AGTCTGACGACTACAAAGGTATGGGTACCACCATCGAAGCGGTTGCGATCGTTGGCGACAACATCATCTTCGCGCACGTTGGTGACTCTCGTATCGGTATCGTTC GTCAGGGTGAATACCATCTGCTGACTTCCGACCACTCTCTGGTTAACGAGCTGGTGAAAGCGGGTCAACTGACCGAAGAAGAAGCGGCGTCTCACCCGCAGAA GAATATCATCACCCAGTCTATTGGCCAGGCGAACCCGGTTGAACCGGACCTGGGCGTCCACCTGCTGGAAGAAGGTGACTACCTGGTTGTTAACTCTGACGGTC TGACCAACATGCTGTCTAACGCGGACATCGCGACCGTTCTGACGCAGGAAAAAACCCTGGACGACAAAAATCAGGACCTGATCACTCTCGCTAACCATCGTGGT GGTCTGGACAATATTACCGTTGCGCTGGTATACGTTGAATCTGAAGCTGTTTAACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGG CCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATA ACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGC GGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTT CCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGG CCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTAT TCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTC AGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGA GCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGG ATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCAT GAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAAC CAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACA CTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGG AGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTT TCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATC CATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGA CCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTG CAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAAT ACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTG GCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCA GGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTG TGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGC GGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAG CCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATC CGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGT GGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAG GGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGT TACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAG CGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAG ACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTC TGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGC TTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTC CAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCA TGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTG CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTG GTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCG AAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTC GGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGG ACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTT AATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGG TGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCAC TGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGA GATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGC GGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAG AGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTT GCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCA AGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCG AGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGA GATCTCGATCCCGCGAAAT
BsaI does not cut the insert. Figure 7.1. pNIC-Bsa4 cut with BsaI restriction enzyme by NEBcutter.
Analysis: The primers designed had acceptable GC content percentages of less than 50%. The melting points were also very close to each other decreasing the chance of error because both primers will be used in the same reaction. The restriction enzyme can be used to cut the vector with the inserted gene in order to ensure that the correct sequence is taken up by the vector.
RE Digest
Figure 6.1. 1% agarose gel w/ 1kb ladder (reference on left) as labeled and uncut pGBR22, pGBR222 cut w/ EcoRI, pGBR22 cut w/ PvuII, and pGBR22 cut with both EcoRI and PvuII in sample wells A, B, C, and D respectively.
Analysis: The bands appeared exactly as expected (See figure 2.2). The EcoRI cut the plasmid resulting in a fragment about 3500 bp. This was located further up on the gel than the uncut plasmid which was also only one fragment because the circular fragment can form into a super coil and get through the gel much more easily than the long cut chain. Sample C had two main bands and sample D had three main bands as expected. However, the samples did have contamination as can be seen by the various lighter bands.
PCR Round 4
Figure 5.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder, sample A (0.3 ng pGBR22), sample B (3 ng pGBR22), sample C (30 ng pGBR22), and sample D (no plasmid added) with 100bp ladder reference to the left.
Analysis: Another failed PCR on my part with only amplification present in sample B. However, these tubes were pipetted from the same dilutions and solutions as my partner, and PCR was done in the same machine with the same settings and timing. I have really bad luck is what I'm trying to say. The following analysis will examine my partner's samples which are ordered in the same fashion as mine. The bands are all in the same horizontal position indicating the correct number of base pairs for pGBR22 (approximately 1000). Sample B showed the most amplification which was unusual because sample C had the most plasmid added to it. This could have just been because PCR was not as effective in sample C as it was in sample B for whatever reason. Sample D was also unusual because no plasmid was added, but there was a band. Slight contamination from other samples could easily explain this, especially because the band is in the same position as the ones with the pGBR22 plasmid, indicating that it a little bit of pGBR22 was also present in sample D.
PCR Round 3
Figure 4.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder in well on the far right, sample A (0.3 ng pGBR22), sample B (3 ng pGBR22), sample C (30 ng pGBR22), and sample D (no plasmid added).
Analysis: This gel turned out similarly to the first PCR gel run. Possible sources of error include placing the reaction tubes towards the outer ring of the PCR machine causing temperature fluctuations and an inadequate environment for the reaction.
PCR Round 2 Figure 3.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder in well one (left), sample A (0.3 ng pGBR22) in well 2, sample B (3 ng pGBR22) in well 3, sample C (30 ng pGBR22) in well 4, and sample D (no plasmid added).
Analysis: Although there are slight bands for sample C, they do not line up with where pGBR22 is expected to be and are probably the result of contamination. A possible reason for another failed gel may be not pipetting up and down to ensure that the small plasmid amount added was mixed into the solutions.
Week 1 & 2
Caroline, good job, include one SNIP of your final virtual gel from the Analyze DNA seq. . And, re-do PCR this week. - Dr. B 090913 Analyzing DNA Sequences
Figure 2.2. Virtual gel of marker lane, pGBR22 cut with EcoRI (second to left), pGBR22 cut with PvuII (second to right), and pGBR22 cut with PvuII and EcoRI (far right) as obtained from NEBcutter.
Analysis: After restriction enzymes are added to the tubes of plasmid, they will be run on gels. The virtual gel should be representative of what is actually seen on the gel. EcoRI cuts at one point resulting in one fragment (band). PvuII cuts in two places resulting in two fragments (2 bands). Therefore, a tube with both EcoRI and PvuII should have 3 cuts resulting in three fragments (3 bands).
PCR and Gel
Figure 2.1. Failed agarose gel with 100bp ladder in well one (left), sample A (10 ul of 1:1000 dilution of 100 mM stock pGBR22) in well 2, sample B (10 ul of 1:1000 dilution of 100 mM stock pGBR22) in well 3, sample C (10 ul of 1:100 dilution of 100 mM stock pGBR22) in well 4, and sample D (no plasmid added) in well 5 (second to the right).
Analysis: The expected image was for the band widths to be located in the same area, indicating the size of the pGBR22 protein, but increasing in width going from sample A to sample C, indicating an increase in plasmid concentration. The well with sample D was to have no band because no plasmid was added. However, the bands for all samples did not appear. This is likely due to PCR failing which could have been caused from not putting the samples in the PCR machine fast enough, causing TAQ polymerase to degrade.
Figure 1.3. Primer sequence for gene serine-threonine phosphatase (STP1) in organism Streptococcus agalactiae A909 with codon optimization for E. coli class II.
Analysis: To cover the CDS of STP1 in S. agalactiae, 18 primers are needed according to the DNAworks output file. These primers are codon optimized for E. coli class II in order to help with the process of transformation later on. They will be mixed in a reaction tube and primary PCR will replicate the primers so that many DNA strands covering the entire CDS can be made from the 18 templates.
Nanodrop
Figure 1.1 Absorbance curve of pGBR22 at wavelength of 230 with concentration reading of 202.8 ng/uL.
Figure 1.2 Absorbance curve of pGBR22 at wavelength of 260nm with concentration reading of 206.8 ng/uL.
Average of the two readings: (202.8 +206.8)/2 = 204.8 ng/uL
Listed known concentration**: 205.4 ng/uL
Analysis: The absorbance of the pGBR22 sample was measured at 260nm which resulted in an average concentration of 204.8 ng/uL as opposed to the listed known concentration of 205.4 ng/uL. This was a percent error of .291%. The purity of the solution was also determined by looking at the 260/280 and 260/230 ratios. The 260/280 ratio indicates the protein contamination with accepted "pure" value of around 1.8 which is lower than the obtained 1.94. The purity of the solution relative to other contaminants is indicated by the 260/230 ratio which has an accepted "pure" value of about 2.1. The ratio obtained was much lower than this accepted value and indicate that the sample had other contaminants that absorb at 230 nm.
Virtual Screening
Table 23.5.
Lipinski Data for the Top 10 Ligands in Each Library (CB306, HF9, InHouse, NIH Clinical Collection). Lipinski Rules Changed to <700 g/mol and <2.5 LogP value.
Analysis: Based on the screening process, the NIH Clinical Collection ligands were most worth pursuing due to their high fitness scores. However, many of these compounds had values that did not satisfy the modified Lipinski or were unavailable. Thus, Enalaprilat from the NIH Clinical Collection and AC1OPXUX from the CB306 library are the compounds that have the highest hopes in binding during the inhibition assay due to their high fitness scores and their drug-like physicochemical properties.
Figure 23.4. Positive inhibitor 3 as green sticks with active site of SaSTP1 (PDB ID:2PK0) as pink sticks with magnesium cofactors as lime green spheres. Polar contacts shown in black dashes.
Figure 23.3. Negative Control 5 as green sticks with active site of SaSTP1 (PDB ID:2PK0) as pink sticks with magnesium cofactors as lime green spheres. Polar contacts shown in black dashes.
Analysis: These are the binding poses of the top positive and top negative control. As expected, the top positive control seems to bind correctly, making polar contacts with the magnesium cofactors which are both necessary for binding. The negative control, on the other hand, doesn't seem to make any polar controls to one of the magnesium cofactors, indicating that although it had a high score compared to some of the ligands, it most likely will not bind well in vitro.
Table 23.2. Fitness scores and bond subscores as determined by GOLD of the control library containing 11 positive controls and 5 negative/random controls.
Analysis: Overall, the scores are pretty low but it may just be the protein or the specific run. The control docking validated GOLD because most of the positive controls were seen towards the top of the ranks. Some reasons for the lower scoring positive controls are that the inhibitors were found in viral organisms instead of bacteria and that they are not specifically for STP1 but rather for general serine/threonine phosphatase.
Table 23.1. The physicochemical properties of the control library used to validate GOLD.
(Positive 1)
(Positive 2)
(Positive 3)
(Positive 4)
(Positive 5)
(Positive 6)
(Positive 7)
(Positive 8)
(Positive 9)
(Positive 10)
(Positive 11)
(Negative 2)
(Negative 3)
(Negative 4)
(Negative 5)
Analysis: The positive controls were chosen because they are already known inhibitors of Serine-Threonine Phosphatases. The negative controls were chosen based on similar physicochemical properties. However, it is unlikely that they will bind because the current inhibitors do not have that much in common so the filtered search range was pretty large. The negatives also all have ring structures while only one of the positive controls have a single ring structure. Thus it is even more unlikely that they will bind successfully.
Inhibition Assay
Figure 22.3. Absorbance measurements at 410 nm for trial 2 of varying inhibitor compound concentrations against the enzyme YopH using pNPP as a substrate. Four total controls indicated: no enzyme control, two no inhibitor controls, and one positive orthonavadate control). N=1 so no standard deviation error bars were created.
Figure 22.2. Absorbance measurements at 410 nm for trial 1 of varying inhibitor compound concentrations against the enzyme YopH using pNPP as a substrate. Four total controls indicated: no enzyme control, two no inhibitor controls, and one positive orthonavadate control). N=1 so no standard deviation error bars were created.
Analysis: In both trials, the inhibition assay did not work. In trial 1, the positive control had absolutely no signal as compared to the no enzyme control which was unusual because although it is supposed to successfully inhibit the YopH enzyme from working, there should be a small amount of signal rather than no signal at all. In trial 2, the exact opposite was true where the signal from the positive control was about equal to the signals received when no inhibitor was added at all. This indicates that the positive control did not actually successfully inhibit all of the enzyme. Furthermore, compound 5852635, which had been proven to indeed inhibit YopH by others' research, also transmitted a large signal when added. It is likely that this was the result of choosing a saturated enzyme concentration from the enzymatic assay. As can be seen in the enzyme assay graph, the absorbance readings began to level off as the concentration was increased. Thus, in the inhibitory assay, there was likely not enough inhibitor compound to inhibit the exceedingly large amount of enzyme in the reactions. The most important piece of information taken from the inhibition assay was that as the inhibitor compound was increased in concentration, the absorbance measurement did decrease showing that the compound was somewhat effective and that the source of error was indeed the amount of enzyme added to the reaction.
Enzyme Assay
Figure 22.1. Absorbance measurements at 410 nm for varying enzymatic concentrations in nM of YopH with standard deviation error bars. Second point is an outlier. Reaction used pNPP as a substrate (more information can be found in the materials and methods portion).
Analysis: With the exception of the second point as an outlier, the absorbance measurement at 410 nm increased as the enzyme concentration increased. This is because there was more enzyme to catalyze the reaction involving the cleaving of the phosphate group off of the substrate pNPP. With the addition of NaOH, a p-Nitrophenylene anion is formed which is yellow is color and absorbs wavelengths at about 410 nm. The second the last point on the graph was the chosen concentration for inhibition assays.
Week 13 & 14
FPLC (Fast Protein Liquid Chromatography)
Figure 21.6. Absorbance measured at 280 nm of YopH after FPLC and being concentrated with a concentration of 1.06 mg/ml.
Analysis: The resulting concentration was 1.06 mg/ml which is a pretty decent concentration. The purified enzyme will be used in enzymatic assays next to ensure that they are functional before moving on to inhibitory assays.
Figure 21.5. Concentration of 0.43 mg/ml for YopH after FPLC with absorbance measured at 280 nm.
Analysis: The concentration was considerably lower after FPLC. However, this can be increased by spinning down the sample in a concentrator.
Figure 21.4. FPLC of YopH indicated in solid blue separated into tubes labeled in red. Size standard comparison run separately indicated in dashed blue line to help identify correct protein.
Analysis: Before FPLC, two samples were combined to increase the concentration because a lot of the sample is lost during FPLC. The size standard run is indicated in the blue dotted line where the largest peak on that line corresponds to a size of approximately 50 kDa. The smaller peak towards the end (right) of the graph corresponds to a size of approximately 30 kDa. Thus, it was evident that the largest peak on the blue solid line was the YopH protein at approximately 34 kDa. The peak corresponded to tubes 39-44 which were collected while the rest of the sample was discarded.
Protein Characterization
Figure 21.3. SDS-Page gel run with 1x TGS buffer. PageRuler Prestained Protein Ladder #SM0671 (reference left) in well 1, sample 0 (cell lysate before induction) in well 2, sample 1 (cell lysate after induction) in well 3, sample 2 (soluble fraction) in well 4, sample 3 (flow through) in well 5, sample 4 (wash step) in well 6, sample 5 (elution 1) in well 7, and sample 6 (elution 2) in well 8.
Analysis: The protein ended up in the elution 1 and elution 2 samples as expected which can be seen by the large bands at approximately 34 kDa, the size of YopH. There was, however, more contamination than wanted. Thus, it was decided that the samples would be put through a second degree of purification by running it through fast protein liquid chromatography.
Protein Purification
Figure 21.3. Absorbance measured at 280 nm for the purified YopH surrogate protein from the expression vector E. coli BL21(DE3) resulting in a concentration of 0.46 mg/ml.
Figure 21.2. Absorbance measured at 280 nm for the purified YopH protein from the expression vector E. coli BL21(DE3) resulting in a concentration of 2.12 mg/ml.
Analysis: The concentration for elution 1 was pretty high but not abnormally high indicating good protein expression. As expected, the elution 2 concentration was lower but not 0 because most of the protein was eluted the first time with only some remaining because of the level of buffer above the resin. The sample may need to be further purified through FPLC depending on what the elution samples look like on the protein characterization gel.
Protein Expression
Figure 21.1. Spinned down lysed E. coli BL21(DE3) cells. Supernatant discarded with pellet on right representing remaining protein.
Analysis: The OD600 of the cells was measured before inducing them with IPTG to ensure that the E. coli BL21(DE3) cells were in log phase growth to optimize the protein recovery. A nice size pellet was formed, hopefully resulting in large protein yields.
Week 11 & 12
DNA Sequencing
Figure 20.2. Ordered samples (one using forward and one using reverse pLIC for each sample) created with 500 ng of purified pNIC-Bsa4 + CDS of SaSTP1.
Figure 20.1. Order summary of the 12 samples (one forward and one reverse primer for each sample obtained through mini-prep) submitted to the ICMB Core.
Analysis: There are a total of 12 samples because both forward and reverse primers are needed for each sample. This is because DNA sequencing tends to read worse towards the end of the frame. By having samples containing forward or reverse sequencing primers, the sequences can be aligned to determine whether a positive clone was present or not. The results came back and, as expected, were highly mutated. From here, protein protocol practice will be done on surrogate enzymes. In the event that there are positive clones made by my teammates, I will likely jump back onto this target.
Mini-Prep
Figure 19.6. Absorbance reading of sample 5 at 260 nm after mini-prep with concentration of 219.1 ng/ul and purity ratios of 1.83 (260/280) and 1.99 (260/230).
Figure 19.5. Absorbance reading of sample 7 at 260 nm after mini-prep with concentration of 62.4 ng/ul and purity ratios of 1.81 (260/280) and 1.68 (260/230).
Figure 19.4. Absorbance reading of sample 4 at 260 nm after mini-prep with concentration of 311.4 ng/ul and purity ratios of 1.77 (260/280) and 1.86 (260/230).
Figure 19.3. Absorbance reading of sample 3 at 260 nm after mini-prep with concentration of 331.6 ng/ul and purity ratios of 1.82 (260/280) and 2.03 (260/230).
Figure 19.2. Absorbance reading of sample 2 at 260 nm after mini-prep with concentration of 228.6 ng/ul and purity ratios of 1.82 (260/280) and 1.94 (260/230).
Figure 19.1. Absorbance reading of sample 1 at 260 nm after mini-prep with concentration of 229.9 ng/ul and purity ratios of 1.83 (260/280) and 1.98 (260/230).
Analysis: For all the samples, the concentration was only used in order to submit the correct amount in ng for DNA sequencing. They were not of great importance for yield because they just indicated how well the bacteria grew and did not account for mutations. Although the purity ratios were very close to acceptable values of a pure sample, again, this only shows that other things growing had been killed off by kanamycin, leaving only the potentially mutated bacteria.
pNIC-Bsa4 Cloning (Attempt 2 & 3)
Annealing and Transformation
Figure 18.2. Kanamycin and sucrose positive master plate made from the smaller colonies of the 4 transformation plates combined.
Figure 18.1. Kanamycin and sucrose positive agar transformation plates of BE21 competent cells with pNIC-Bsa4 and CDS of SaSTP1. Top left is a 1 pNIC-Bsa4 : 2 CDS of SaSTP1 ratio using the 28 ng/ul pNIC-Bsa4 sample. Bottom left is a 1 pNIC-Bsa4 : 9 CDS of SaSTP1 ratio using the 28 ng/ul pNIC-Bsa4 sample. Top right is a 1 pNIC-Bsa4 : 9 CDS of SaSTP1 ratio using the 35 ng/ul pNIC-Bsa4 sample. Bottom right is a 1 pNIC-Bsa4 : 2 CDS of SaSTP1 ratio using the 35 ng/ul pNIC-Bsa4 sample.
Analysis: The growth was highly unusual and may have indicated that the plates used did not actually have kanamycin on them. The select colonies used for the master plate were also grown up in LB that did contain kanamycin. Because some of these colonies did form pellets after centrifugation with the addition of kanamycinn, it is possible that they can be clones. Thus, DNA sequencing was done for the ones that made substantial pellets (#1, 2, 3, 4, 7, 9). However, because the outgrowth of "stuff" was so drastic in the original plates, it is likely that the bacteria forming these pellets are highly mutated and have been transformed with something else as well.
Week 9 & 10
pNIC-Bsa4 Cloning (Attempt 2 & 3)
Annealing and Transformation
Both samples as well as the PCR squared product had cohesive ends added to them. They were then combined. Each sample was split into two tubes. Tube A of both had a 1 pNIC-Bsa4 : 2 CDS ratio. Tube B of both had a 1 pNIC-Bsa4 : 9 CDS ratio. They were left to grow overnight. After one day, there were no signs of growth. However, after another day, some bacterial growth appeared. The plate was moved to the fridge for storage, and the colonies will be tested to see if there are any positive clones.
Re-Digest of pNIC-Bsa4 2 & 3
These samples were not checked on a gel to save some time.
*The grown pNIC-Bsa4 from before was separated into two different samples for two more attempts at cloning before being treated with restriction enzyme BsaI-HF.
Figure 17.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 35.6 ng/uL and purity ratios of 1.92 (260/280) and 1.95 (260/230).
Figure 17.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 36.0 ng/uL and purity ratios of 1.97 (260/280) and 2.42 (260/230).
Average Concentration: 35.8 ng/uL
Figure 16.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 28.2 ng/uL and purity ratios of 2.12 (260/280) and 2.28 (260/230).
Figure 16.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 29.4 ng/uL and purity ratios of 2.02 (260/280) and 2.10 (260/230).
Average Concentration: 28.8 ng/uL
Analysis (for both samples): Both samples had less concentration after it was treated with BsaI-HF and cleaned up. However, the concentration is still worth a try at cloning despite it being lower. The purity ratios were about the same as the first attempt at cloning.
NanoDrop of grown pNIC-Bsa4 (Second Time)
Figure 15.2. Absorbance of pNIC-Bsa4 purified from DH5alpha bacterial cells at wavelength 260 nm with concentration of 51.0 ng/uL and purity ratios of 1.96 (260/280) and 2.91 (260/230).
Figure 15.1. Absorbance of pNIC-Bsa4 purified from DH5alpha bacterial cells at wavelength 260 nm with concentration of 51.5 ng/uL and purity ratios of 1.87 (260/280) and 2.99 (260/230).
Average Concentration: 51.25 ng/uL
Analysis: Unfortunately, I accidentally eluted the pNIC-Bsa4 in 50 uL instead of 30 uL so the concentration is lower than it would have been otherwise. Despite this, the concentration was still higher than the first time growing pNIC-Bsa4. The purity ratios are also better.
PCR Clean-Drop & NanoDrop (Second Time)
Figure 14.2. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 180.5 ng/uL and purity ratios of 1.90 (260/280) and 2.34 (260/230).
Figure 14.1. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 178.9 ng/uL and purity ratios of 1.87 (260/280) and 2.32 (260/230).
Average Concentration: 179.7 ng/uL
Analysis: The concentration of this sample was much higher than the previous PCR clean-up, giving high hopes for successful cloning. The purity ratios are also much better with the ratio in proportion to other proteins very close to the acceptable value of 1.80 and the ratio in proportion to other contaminants much closer to the acceptable 2.10 as compared to the negative value obtained the first time. This PCR product will be inserted into pNIC-Bsa4 which will then be used to transform DH5alpha competent cells.
PCR Squared (Second Time)
Figure 13.1.
1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left) with four 3 uL samples of PCR squared reactions (wells 5-8) and secondary PCR in well 4 for comparison.
Analysis: In order to make more CDS for SaSTP1, PCR squared was done again from remaining secondary PCR product. Although the bands were not as high intensity as the last PCR squared, it may have just been because only 3 uL of each aliquot was run in each lane. There is still evidence that amplification occurred because the bands are slightly more intense than the secondary PCR sample in well 4. The concentration of the PCR squared product will be determined after PCR clean up to see if PCR squared must be redone.
Week 7 & 8
Great work in the wet lab Caroline. Great captions and analysis. Keep up the good work. Where exactly are you with virtual though? Thank you. -Max 10/21/13
pNIC-Bsa4 cloning
2) Cohesive End Generation, Annealing and Transformation (Attempt #1 - Failed): Cohesive ends were created by using T4 DNA polymerase to extend the sticky ends of both the PCR inserts (amplified CDS of SaSTP1 protein) and the accepting vector (pNIC-Bsa4). These were mixed in two different tubes, one with a 1:2 ratio of accepting vector to PCR insert, and the other with a 1:8 ratio of accepting vector to PCR insert. Competent DH5alpha bacterial cells were added to each tube which were then spread on kanamycin and sucrose positive LB agar plates in hopes of transforming them with the annealed plasmid containing the CDS.
Analysis: No bacterial growth appeared on the plates after an incubation period of 1-2 days at 37 degrees Celsius. This shows that transformation of the bacterial cells failed because none of the bacteria had kanamycin resistence (coded for in the pNIC-Bsa4 plasmid) and thus died.
Conclusion/Next Steps: There were no apparent faults such as using the wrong buffer, not having pNIC-Bsa4, or having incredibly low concentrations of both accepting vector and CDS. Some possible changes for the second attempt could include using more recent reagents and warmer SOC to ensure higher efficacy in transformation. However, because I currently have no more PCR product or pNIC-Bsa4 left, the first thing to do will be to make bulk of both before extra attempts at transforming.
1) pNIC-Bsa4 Clean Up, RE Digest, & Gel Check: The extracted pNIC-Bsa4 from the Midi-Prep protocol was run through the clean up kit to reduce contamination and treated with restriction enzyme BsaI-HF to see if the correct sequence was produced from transformation of the DH5alpha bacterial cells.
Figure 12.4. Virtual cut of pNIC-Bsa4 by restriction enzyme Bsa-I into two fragments of lengths 5353 bp and 1931 bp as provided by NEBCutter.
Figure 12.3. pNIC-Bsa4 (well 4) treated with restriction enzyme BsaI-HF with 1 kb ladder (reference left) in well 2.
-Ignore well 3. Accidentally loaded 100bp ladder.
Figure 12.2. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 40.6 ng/uL and purity ratios of 1.82 (260/280) and 2.57 (260/230).
Figure 12.1. Absorbance of cleaned up pNIC-Bsa4 treated with restriction enzyme BsaI-HF at wavelength 260 nm with concentration of 38.1 ng/uL and purity ratios of 1.81 (260/280) and 2.83 (260/230).
Average concentration: (40.6 ng/uL + 38.1 ng/uL) / 2 = 39.35 ng/uL
Analysis: Based on the resitrction enzyme virtual cut, 2 fragments of lengths 5353 bp and 1931 bp should appear if the sequence cut is pNIC-Bsa4 (information obtained from NEBcutter). As seen in figure 12.3, this is exactly what appeared on the gel, indicating that the DNA extracted during midi-prep was indeed pNIC-Bsa4. After checking the concentration using the Nanodrop spectrophotometer, the average concentration was 39.35 ng/uL. This was, again, and okay yield. The reason for the higher concentration as compared to that measured after midi-prep is because of the volume of sample (in this case, it was 30 uL total). The purity ratio in respect to other proteins (260/280) was still within an acceptable range for both readings. Although the purity ratio in respect to other contaminants decreased from that measured during the Midi-Prep protocol, it was still not that close to the accepted value of 2.1. However, there are other purification processes that can be done later on if cloning is successful and the target protein is expressed. Hence, the sample was still used.
Midi-Prep (Extracting pNIC-Bsa4 from DH5alpha)
Figure 11.2. Absorbance of pNIC-Bsa4 extracted from DH5alpha bacterial cells at wavelength 260 nm with concentration of 32.4 ng/uL and purity ratios of 2.01 (260/280) and 3.50 (260/230).
Figure 11.1. Absorbance of pNIC-Bsa4 extracted from DH5alpha bacterial cells at wavelength 260 nm with concentration of 36.2 ng/uL and purity ratios of 2.00 (260/280) and 3.39 (260/230).
Average Concentration: (36.2 ng/uL + 32.4 ng/uL) / 2 = 34.30 ng/uL
Analysis: The average concentration of both readings was 34.30 ng/uL. This is an okay yield so the sample was used in the following step of cutting the pNIC-Bsa4. The purity of the sample was good for the 260/280 ratio indicating not much contamination in respect to other proteins, but the value for the 260/230 ratio was high indicating other contaminants.
Conclusion: In this step, the accepting vector pNIC-Bsa4 that was grown up in DH5alpha bacterial cells was extracted. The absorbances of the obtained samples were measured using the Nanodrop spectrophotometer. After further preparation of the pNIC-Bsa4, it will be used to anneal to the CDS of the target protein SaSTP1 which will then be cloned in bacterial cells in order to obtain the target protein.
Note: I was supposed to send this to DNA sequencing but I forgot to do so before cutting it with the BsaI-HF restriction enzyme. However, as can be seen above, the RE digest did indicate that the sample was indeed pNIC-Bsa4.
Transformation of DH5alpha bacterial cells with pNIC-Bsa4
- pNIC-Bsa4 and bacteria were combined in a test tube, heat shocked, treated with SOC, and allowed to grow on LB agar plates. A secondary culture was made from one colony after a day. This was allowed to incubate for 18 hours (although the protocol said 16 hours max) before being spun down into pellets.
Analysis/Conclusion: The secondary culture was made in order to obtain a homogeneous sample. The pellets will used during Midi-Prep in which the pNIC-Bsa4 in the transformed bacterial cells will be extracted.
PCR Clean-Up & NanoDrop
Figure 10.2. The absorbance measurement at 260 nm for the same sample of CDS of STP1 in S. agalactiae after PCR clean-up with yield of 92.3 ng/uL and purity ratios of 1.91 (260/280) and -5.37 (260/230).
Figure 10.1. The absorbance measurement at 260 nm for the CDS of STP1 in S. agalactiae after PCR clean-up with yield of 87.1 ng/uL and purity ratios of 1.88 (260/280) and -5.01 (260/230).
Analysis: The average yield after PCR clean-up was 89.7 ng/uL. Although the purity ratios indicated a considerable degree of contamination, this may have just been the result of using the incorrect elution buffer causing background noise to be picked up at the wavelengths measured. From here, the DNA will be inserted into pNIC-BSA4 which will then be used to transform bacteria in order to express large amounts of the STP1 (from S. agalactiae) protein.
Awesome job with the image labeling! But be sure to specify what is in each well in your captions. Keep up the good work! - Michael T.
Week 5 & 6
PCR Squared
Figure 9.1. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left) with four 50 uL aliquots of PCR squared reactions.
Analysis: PCR squared was successful as can be seen by the high intensity of the bands in all four aliquots. There was a bit of contamination that was also amplified, but an attempt at removing it will be made in PCR clean up. The bands are again at the expected length (738 bp). PCR squared may have to be done multiple times to obtain even more CDS for STP1 from S. agalactiae because both clean up and protein expression require a lot of DNA to be successful and have high yields.
Primary PCR & Secondary PCR
Figure 8.2. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left), primary PCR smear in well 3, and secondary PCR band in well 4 for the CDS of STP1 derived from S. agalactiae.
Analysis: Although the second run of primary PCR showed no visible smear on the gel, secondary PCR worked, indicating that primary PCR was also successful. This sample was much less contaminated than the first because autoclaved nanopure water was used and more care was taken, though not in handling the gel as can be seen by the crack that was caused by accidentally dropping the gel. HAHA. Luckily, the band for secondary PCR was still visible. Again, it appeared between the 700 and 800 bp bands, where it was expected to be (738 bp).
Figure 8.1. 1% agarose gel run with 1x TAE1/ 100 bp ladder (Generuler; reference on left), primary PCR smear in well 3, and secondary PCR band in well 4 for the CDS of STP1 derived from S. agalactiae.
Analysis: The primary PCR reaction worked and showed a smear which was the result of amplification of varying lengths of the CDS. The secondary PCR showed a band at the expected amount of basepairs (738 bp) as can be seen when compared to the ladder, but also had a considerable amount of contamination. However, during secondary PCR, the lid of the machine was closed too tightly causing the tube to deform.Thus it was not possible to save the sample without risk of increased contamination. Both primary and secondary PCR were done a second time in order to decrease the amount of contamination.
Week 3 & 4
Caroline - good work, need one attempt at Primary PCR. - Dr. B 092513
Primer Tail Ordering
Figure 7.2. Order summary of the forward and reverse tail primers for the STP1 protein's CDS in S. agalactiae codon optimized for E. coli class II.
Analysis: These primer tails will be used later in secondary PCR to amplify the gene of interest (CDS of STP1 protein in S. agalactiae in this case).
Primer Tail Design
Forward Primer: 5’ TACTTCCAATCCATGGAAATCTCTCTCCTG 3’
GC Content: 43%
0 mM Mg2+ Tm:59.7˚C 1.5 mM Mg2+ Tm: 66.9˚C 2mM Mg2+ Tm: 67.4˚C
4mM Mg2+ Tm: 68.5˚C 6mM Mg2+ Tm: 69.0˚C
Downstream Primer: 5’ TATCCACCTTTACTGTTAAACAGCTTCAGATTC 3’
GC Content: 36.4%
0 mM Mg2+ Tm:58.7˚C 1.5 mM Mg2+ Tm: 66.5˚C 2mM Mg2+ Tm: 67.0˚C
4mM Mg2+ Tm: 68.1˚C 6mM Mg2+ Tm: 68.6˚C
Vector with Inserted Gene of Interest (Blue for 6HIS tag; yellow for tail primers that align with pNIC-Bsa4; green for start codon; purple for primer portion that overlaps with CDS; red for stop codon; underlined is the entire CDS)
TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGCACCATCATCATCATC
ATTCTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCATGGAAATCTCTCTCCTGACTGACATCGGTCAACGTCGCTCTAATAACCAGGACTTCATC
AATCAGTTCGAAAACAAGGCCGGTGTTCCGCTCATCATCCTGGCGGACGGCATGGGCGGTCACCGTGCGGGTAACATTGCGAGCGAAATGACCGTTACCGATC
TGGGCTCTGACTGGGCGGAAACCGACTTCTCTGAACTGTCTGAAATCCGTGACTGGATGCTCGTTTCTATCGAAACGGAAAACCGTAAAATCTACGAACTGGGTC
AGTCTGACGACTACAAAGGTATGGGTACCACCATCGAAGCGGTTGCGATCGTTGGCGACAACATCATCTTCGCGCACGTTGGTGACTCTCGTATCGGTATCGTTC
GTCAGGGTGAATACCATCTGCTGACTTCCGACCACTCTCTGGTTAACGAGCTGGTGAAAGCGGGTCAACTGACCGAAGAAGAAGCGGCGTCTCACCCGCAGAA
GAATATCATCACCCAGTCTATTGGCCAGGCGAACCCGGTTGAACCGGACCTGGGCGTCCACCTGCTGGAAGAAGGTGACTACCTGGTTGTTAACTCTGACGGTC
TGACCAACATGCTGTCTAACGCGGACATCGCGACCGTTCTGACGCAGGAAAAAACCCTGGACGACAAAAATCAGGACCTGATCACTCTCGCTAACCATCGTGGT
GGTCTGGACAATATTACCGTTGCGCTGGTATACGTTGAATCTGAAGCTGTTTAACAGTAAAGGTGGATACGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGG
CCGCACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATA
ACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGC
GGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTT
CCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGG
CCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTAT
TCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTC
AGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGA
GCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGG
ATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCAT
GAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAAC
CAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACA
CTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGG
AGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTT
TCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATC
CATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGA
CCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTG
CAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAAT
ACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTG
GCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA
GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCA
GGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTG
TGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGT
TATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGC
GGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAG
CCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATC
CGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGT
GGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAG
GGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGT
TACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAG
CGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAG
ACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTC
TGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGC
TTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTC
CAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCA
TGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTG
CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTG
GTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCG
AAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTC
GGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGG
ACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTT
AATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGG
TGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCAC
TGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGA
GATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGC
GGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAG
AGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTT
GCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCA
AGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCG
AGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGA
GATCTCGATCCCGCGAAAT
BsaI does not cut the insert.
Figure 7.1. pNIC-Bsa4 cut with BsaI restriction enzyme by NEBcutter.
Analysis: The primers designed had acceptable GC content percentages of less than 50%. The melting points were also very close to each other decreasing the chance of error because both primers will be used in the same reaction. The restriction enzyme can be used to cut the vector with the inserted gene in order to ensure that the correct sequence is taken up by the vector.
RE Digest
Figure 6.1. 1% agarose gel w/ 1kb ladder (reference on left) as labeled and uncut pGBR22, pGBR222 cut w/ EcoRI, pGBR22 cut w/ PvuII, and pGBR22 cut with both EcoRI and PvuII in sample wells A, B, C, and D respectively.
Analysis: The bands appeared exactly as expected (See figure 2.2). The EcoRI cut the plasmid resulting in a fragment about 3500 bp. This was located further up on the gel than the uncut plasmid which was also only one fragment because the circular fragment can form into a super coil and get through the gel much more easily than the long cut chain. Sample C had two main bands and sample D had three main bands as expected. However, the samples did have contamination as can be seen by the various lighter bands.
PCR Round 4
Figure 5.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder, sample A (0.3 ng pGBR22), sample B (3 ng pGBR22), sample C (30 ng pGBR22), and sample D (no plasmid added) with 100bp ladder reference to the left.
Analysis: Another failed PCR on my part with only amplification present in sample B. However, these tubes were pipetted from the same dilutions and solutions as my partner, and PCR was done in the same machine with the same settings and timing. I have really bad luck is what I'm trying to say. The following analysis will examine my partner's samples which are ordered in the same fashion as mine. The bands are all in the same horizontal position indicating the correct number of base pairs for pGBR22 (approximately 1000). Sample B showed the most amplification which was unusual because sample C had the most plasmid added to it. This could have just been because PCR was not as effective in sample C as it was in sample B for whatever reason. Sample D was also unusual because no plasmid was added, but there was a band. Slight contamination from other samples could easily explain this, especially because the band is in the same position as the ones with the pGBR22 plasmid, indicating that it a little bit of pGBR22 was also present in sample D.
PCR Round 3
Figure 4.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder in well on the far right, sample A (0.3 ng pGBR22), sample B (3 ng pGBR22), sample C (30 ng pGBR22), and sample D (no plasmid added).
Analysis: This gel turned out similarly to the first PCR gel run. Possible sources of error include placing the reaction tubes towards the outer ring of the PCR machine causing temperature fluctuations and an inadequate environment for the reaction.
PCR Round 2
Figure 3.1. Failed 1% agarose gel run with TAE buffer with 100bp ladder in well one (left), sample A (0.3 ng pGBR22) in well 2, sample B (3 ng pGBR22) in well 3, sample C (30 ng pGBR22) in well 4, and sample D (no plasmid added).
Analysis: Although there are slight bands for sample C, they do not line up with where pGBR22 is expected to be and are probably the result of contamination. A possible reason for another failed gel may be not pipetting up and down to ensure that the small plasmid amount added was mixed into the solutions.
Week 1 & 2
Caroline, good job, include one SNIP of your final virtual gel from the Analyze DNA seq. . And, re-do PCR this week. - Dr. B 090913
Analyzing DNA Sequences
Figure 2.2. Virtual gel of marker lane, pGBR22 cut with EcoRI (second to left), pGBR22 cut with PvuII (second to right), and pGBR22 cut with PvuII and EcoRI (far right) as obtained from NEBcutter.
Analysis: After restriction enzymes are added to the tubes of plasmid, they will be run on gels. The virtual gel should be representative of what is actually seen on the gel. EcoRI cuts at one point resulting in one fragment (band). PvuII cuts in two places resulting in two fragments (2 bands). Therefore, a tube with both EcoRI and PvuII should have 3 cuts resulting in three fragments (3 bands).
PCR and Gel
Figure 2.1. Failed agarose gel with 100bp ladder in well one (left), sample A (10 ul of 1:1000 dilution of 100 mM stock pGBR22) in well 2, sample B (10 ul of 1:1000 dilution of 100 mM stock pGBR22) in well 3, sample C (10 ul of 1:100 dilution of 100 mM stock pGBR22) in well 4, and sample D (no plasmid added) in well 5 (second to the right).
Analysis: The expected image was for the band widths to be located in the same area, indicating the size of the pGBR22 protein, but increasing in width going from sample A to sample C, indicating an increase in plasmid concentration. The well with sample D was to have no band because no plasmid was added. However, the bands for all samples did not appear. This is likely due to PCR failing which could have been caused from not putting the samples in the PCR machine fast enough, causing TAQ polymerase to degrade.
PCR Primer Design
----------------------------------------------------------------
18 oligonucleotides need to be synthesized
----------------------------------------------------------------
1 ATGGAAATCTCTCTCCTGACTGACATCGGTCAACGTCGCTCTAATAACCAGGACTTCA 58
2 GATGAGCGGAACACCGGCCTTGTTTTCGAACTGATTGATGAAGTCCTGGTTATTAGAGCG 60
3 CCGGTGTTCCGCTCATCATCCTGGCGGACGGCATGGGCGGTCACCGTGCGGGTAACATTG 60
4 CCGCCCAGTCAGAGCCCAGATCGGTAACGGTCATTTCGCTCGCAATGTTACCCGCACGGT 60
5 GGCTCTGACTGGGCGGAAACCGACTTCTCTGAACTGTCTGAAATCCGTGACTGGATGCTC 60
6 CCAGTTCGTAGATTTTACGGTTTTCCGTTTCGATAGAAACGAGCATCCAGTCACGGATTT 60
7 AAACCGTAAAATCTACGAACTGGGTCAGTCTGACGACTACAAAGGTATGGGTACCACCAT 60
8 GCGAAGATGATGTTGTCGCCAACGATCGCAACCGCTTCGATGGTGGTACCCATACCTTTG 60
9 GCGACAACATCATCTTCGCGCACGTTGGTGACTCTCGTATCGGTATCGTTCGTCAGGGTG 60
10 CTCGTTAACCAGAGAGTGGTCGGAAGTCAGCAGATGGTATTCACCCTGACGAACGATACC 60
11 GACCACTCTCTGGTTAACGAGCTGGTGAAAGCGGGTCAACTGACCGAAGAAGAAGCGGCG 60
12 CCTGGCCAATAGACTGGGTGATGATATTCTTCTGCGGGTGAGACGCCGCTTCTTCTTCGG 60
13 ACCCAGTCTATTGGCCAGGCGAACCCGGTTGAACCGGACCTGGGCGTCCACCTGCTGGAA 60
14 TGTTGGTCAGACCGTCAGAGTTAACAACCAGGTAGTCACCTTCTTCCAGCAGGTGGACGC 60
15 TCTGACGGTCTGACCAACATGCTGTCTAACGCGGACATCGCGACCGTTCTGACGCAGGAA 60
16 AGCGAGAGTGATCAGGTCCTGATTTTTGTCGTCCAGGGTTTTTTCCTGCGTCAGAACGGT 60
17 GGACCTGATCACTCTCGCTAACCATCGTGGTGGTCTGGACAATATTACCGTTGCGCTGGT 60
18 TTAAACAGCTTCAGATTCAACGTATACCAGCGCAACGGTAATATT 45
Figure 1.3. Primer sequence for gene serine-threonine phosphatase (STP1) in organism Streptococcus agalactiae A909 with codon optimization for E. coli class II.
Analysis: To cover the CDS of STP1 in S. agalactiae, 18 primers are needed according to the DNAworks output file. These primers are codon optimized for E. coli class II in order to help with the process of transformation later on. They will be mixed in a reaction tube and primary PCR will replicate the primers so that many DNA strands covering the entire CDS can be made from the 18 templates.
Nanodrop
Figure 1.1 Absorbance curve of pGBR22 at wavelength of 230 with concentration reading of 202.8 ng/uL.
Figure 1.2 Absorbance curve of pGBR22 at wavelength of 260nm with concentration reading of 206.8 ng/uL.
Average of the two readings: (202.8 +206.8)/2 = 204.8 ng/uL
Listed known concentration**: 205.4 ng/uL
Analysis: The absorbance of the pGBR22 sample was measured at 260nm which resulted in an average concentration of 204.8 ng/uL as opposed to the listed known concentration of 205.4 ng/uL. This was a percent error of .291%. The purity of the solution was also determined by looking at the 260/280 and 260/230 ratios. The 260/280 ratio indicates the protein contamination with accepted "pure" value of around 1.8 which is lower than the obtained 1.94. The purity of the solution relative to other contaminants is indicated by the 260/230 ratio which has an accepted "pure" value of about 2.1. The ratio obtained was much lower than this accepted value and indicate that the sample had other contaminants that absorb at 230 nm.